1403/02/31
شیلا امیدظهیر

شیلا امیدظهیر

مرتبه علمی: استادیار
ارکید:
تحصیلات: دکترای تخصصی
اسکاپوس:
دانشکده: دانشکده علوم دریایی و محیطی
نشانی:
تلفن: 011-35305113

مشخصات پژوهش

عنوان
بررسی مورفومتریک و مولکولی انگل ژیروداکتیلوس کوبایاشی در ماهی طلایی Carassius auratus Linnaeus, 1758
نوع پژوهش
مقاله چاپ شده
کلیدواژه‌ها
ماهی طلایی، ژیروداکتیلوس کوبایاشی، ریخت شناسی مولکولی
سال 1394
مجله تحقيقات دامپزشكي - دانشگاه تهران
شناسه DOI
پژوهشگران شیلا امیدظهیر ، حسیتعلی ابراهیم زاده موسوی ، پرویز شایان ، الهه ابراهیم زاده آبکوه ، همایون محمودزاده

چکیده

زمینه مطالعه: ماهیها همواره در معرض عوامل بیماریزای مختلف هستند که در این میان انگلها نقش مهمی دارند. انگل ژبروداکتیلوس از شاخه کر مهای پهن و از جمله انگلهای خارجی تک میزبانه مهم ماهیهای پرورشی و آزاد آ بهای شیرین، شور و ماهیهای زینتی محسوب می شود که می تواند سبب ایجاد بیماری و خسارات اقتصادی قابل توجهی گردد. انگل ژیروداکتیلوس در بین ماهیهای زینتی به ویژه در خانواده کپورماهیان بسیار شایع است. هدف: در این مطالعه انگل ژیروداکتیلوس بر اساس ویژگیهای مورفومتریک و مولکولی در ماهی طلایی مورد بررسی قرار گرفت. روش کار: انگل ژیروداکتیلوس از سطح بدن، پوست، باله ها و آبشش نمونه های ماهی طلایی پس از انتقال به آزمایشگاه توسط گسترش مرطوب جداسازی گردید و توسط میکروسکوپ نوری مورد بررسی قرار گرفت. ویژگیهای ریخت شناسی هریک از انگلها با اندازه گیری قسمتهای مختلف اپیستهاپتور انگل قلاب مرکزی، قلابک حاشیه ای، میله پشتی و میله شکمی انجام شد. جهت بررسی مولکولی گونه انگل ژیروداکتیلوس، پرایمر بالادست، در ناحیه 8/ 5 ژن RNA ریبوزومی )' 5'CGATCATCGGTCTCTCGAAC'3 ( و پرایمر پایین دست، در ناحیه ITS2 ژن RNA ریبوزومی )' 5'TTAAGGAAGAACCACTAGAG'3 ( برای تکثیر DNA گونه های انگل ژیروداکتیلوس به روش PCR ، طراحی گردید. نتایج: ویژگیهای ریختی گونه انگل ژیروداکتیلوس با استفاده از کلیدهای تشخیصی Yamaguti در سال 1961 بررسی گردید، سپس توالی به دست آمده از انگل مورد نظر با توالیهای ثبت شده انگل ژیروداکتیلوس در ژن بانک مورد مقایسه قرار گرفت و نهایتاً انگل ژیروداکتیلوس کوبایاشی شناسایی گردید. نتیجه گیری نهایی: استفاده از نتایج بررسی مورفومتریک همراه با نتایج مولکولی، بهترین روش دستیابی به شناسایی صحیح گونه های جدید این انگل می باشد.