Reduced quantity and motility in sperm are primary causes of men infertility. Before researchers showed that, Ns un 7 gene has roles in sperm motility of mice and mutation in this gene can cause defect in Nsun7 protein function and infertility. This gene in human has a hot spot exon (exon7). Our aim is study of the mutations of the exon7 in the normospermic and asthenoteratospermic men. For this, 60 semen samples including fertile and asthenoteratospermic were collected from IVF center. Semen analysis was performed according to WHO guidelines. A Phenol-chloroform method was used for total DNA extraction from sperm. The exons 7 amplified by forward primer Sun7-F: 5’GACAAATCTCGAAGTCTTGCTG; and reverse primer Sun7-R: 5 ’ -ACATCCTATTTTTGTGAAAAGGGT. Analyses of direct sequences of the PCR products, showed transition mutation (C26232T) in asthenoteratospermic men. This mutation doesn't see in fertile men. Reduced semen parameters such as motility, of the asthenoteratospermic men can be close correlate with this mutation. So, analyses of the exon 7 of the N s un 7 gene can be candidate as a one of diagnosis genetic markers in infertile men.
